109
Modeling of Biomolecular Systems Interactions, Dynamics, and Allostery Poster Session II
54-POS
Board 7
Intrinsic Variations in the Structure of Spacer Regions Can Critically Influence
Transcription
Arvind Marathe,
Prasun Kumar
, Manju Bansal.
Indian Institute of Science, Bangalore, India.
TraR of Agrobacterium tumefaciens is a member of the LuxR family of transcriptional
regulators, which regulates genes that control vegetative replication and conjugal transfer of the
tumour-inducing (Ti) plasmid. It exists as a dimer in the solution with each monomer comprising
of 234 residues. TraR is activated only when the N-terminal domain of each monomer binds to
an autoinducer molecule and C-terminal domain binds to specific DNA sequences (traboxes) of
the target promoters. In this study, we have carried out extensive (60 ns) molecular dynamics
simulations of a free wild-type trabox d(GATGTGCAGATCTGCACATC), the same sequence
with double mutation (G9→C and C12→G) in the spacer region, which eliminates transcription,
a TraR-trabox complex (PDB ID: 1L3L) and unbound TraR. Structural variations in the
dinucleotide step parameters, primarily slide and roll, dictate the binding of traR protein to the
trabox. Mutations affect the groove width and the overall conformation of the trabox by
introducing kinks in the spacer region, possibly making it unfavourable for binding to traR
monomer/dimer. Principal component analysis of motion of each monomer of bound and
unbound TraR shows that each monomer tend to have different conformations. Our analysis
shows that TraR selects a suitably positioned trabox, and that the wild-type trabox is far more
likely to assume such a suitable conformation as compared to the mutated trabox. This study
highlights the influence on protein binding, of the intrinsic structural variations in regions of
DNA that do not directly hydrogen bond to the protein.
